Sự thật THẬT SỰ về thuyết tiến hóa_ Phần 4: Sự tương đồng ADN và LẠI giận hờn sách vở (ADN & SÁCH GIÁO KHOA)

CHỐNG ADN TƯƠNG ĐỒNG

“Các nhà khoa học tuyên bố rằng hemoglobin (huyết sắc tố) của tinh tinh giống hemoglobin của người tới 98%. Điều họ không nói với bạn là hemoglobin của nhiều sinh vật khác kể cả “mốc nhớt” (?) cũng rất giống với hemoglobin của người.”- Mark Eastman, Tiến sĩ Sinh học.
“Một trong những tuyên bố nực cười nữa mà bạn được nghe ngày nay là ADN của người và tinh tinh giống nhau đến 98,3%. [Nhưng] Gene bạn thừa kế từ mẹ và từ bố trung bình là chúng ta chỉ giống nhau tối đa khoảng 93%. -Gary Parker, Tiến sĩ Sinh học”
Còn tôi thì thấy phát biểu của hai ông vừa nực cười vừa đáng buồn. Đáng buồn bởi người Tiến sĩ phải là người đi đầu tạo ra kiến thức cho nhân loại, hai ông lại hùa theo lừa gạt quần chúng. Nực cười bởi người có kiến thức chắp vá như tôi cũng thấy sự thiếu trung thực trắng trợn của hai ông.
Tùy vùng ADN các nhà khoa học chọn xét nghiệm (đều có lí do cả, sau này sẽ có một bài chi tiết về di truyền & tiến hóa nghen), ADN của chúng ta có thể giống tinh tinh và bonobo khoảng 99, 98, 95% (đó là những vùng chúng ta có thể tự tin kiểm tra).
Nhưng những con số tuyệt đối này không có ý nghĩa bằng mối quan hệ tương đối nó cho ta thấy: dù dùng phương pháp nào, ta cũng sẽ thấy tinh tinh gần người nhất, rồi mới tới thú có vú khác như chuột, mới tới động vật khác như ruồi, mới tới nấm như nấm nhầy (slime mold không phải “mốc nhớt” nhé!), rồi mới tới sinh vật nhân thực khác như cây cỏ, rồi mới tới sinh vật nhân sơ như vi khuẩn này nọ. Dù bạn kiểm tra cả vùng không phiên mã, hay những vùng cho virus chèn vào, hay những loại gen bất cứ sinh vật nào cũng có với hàng trăm biến thể có cùng hiệu suất… ta sẽ vẫn thấy cùng một mô-típ, vẽ nên cùng một cái cây rất khớp với cái cây dựng nên từ một ngành không liên quan ví dụ như giải phẫu so sánh. Sẽ không có bất cứ bài kiểm tra trên diện rộng nào cho kết quả kiểu thực vật gần con người>côn trùng>linh trưởng>nấm>gặm nhấm… và sự nhất quán đáng ngạc nhiên đó mới là thứ phản ánh quan hệ tiến hóa. “Tiến sĩ” Eastman có nói với bạn điều đó không?
Câu này có gì đó thiếu thiếu? Phải chăng ý ông Parker là ta chỉ thừa hưởng 50% ADN từ bố và 50% ADN từ mẹ? Thôi, vào vấn đề chính: ý ông là con người chỉ giống nhau tối đa 93%, làm sao tôi có thể giống một con vượn nhiều hơn giống với mẹ mình?
Vậy còn nghiên cứu cho thấy chúng ta chỉ khác nhau có 0.01% gen, và sự giống nhau của chúng ta tỉ lệ thuận với địa lý nhiều hơn ngoại hình, hay cái gọi là “sắc tộc”. Phải chăng có cũng là số liệu người ủng hộ tiến hóa phịa ra? Để đá văng luận điệu “chủng tộc thượng đẳng” mà Darwin ra sức “cổ vũ” hay gì?
Chẳng lẽ tôi giống một người da trắng nhiều hơn mẹ của mình?
Để tôi thử nói thế này coi rõ hơn không:
“Bạn chia sẻ 98% gen với tinh tinh, và 100% với con người.
Và 100% gen người của bạn, 50% trong số đó đến từ mẹ bạn.”
genome as recipe Copyright © 2009 Pearson Education  Inc.2013 Pearson Education  Inc. PowerPoint Lecture prepared by Jill Feinstein Richland Community College Fourth.   ppt download.png
Bạn hãy hình dung thông tin di truyền là một quyển sách dạy nấu ăn, một nhiễm sắc thể (NST) là một chương, một gen là công thức cho một món (tạo ra một protein). Mỗi người chúng ta thừa hưởng hai quyển sách, hay hai bộ NST, một từ cha, một từ mẹ – nhưng cả hai đều là sách hướng dẫn tạo ra Homo sapiens. Hai quyển sách đó là đồng loại, sẽ chứa cùng số công thức/gen, cùng chương chứa công thức/gen, công thức/gen ở cùng một vị trí… nhưng khác một vài chữ, khiến sản phẩm làm ra hơi khác nhau, nhưng rốt cuộc vẫn tạo ra 100% con người.
Khi ta nói ta có 98% gen giống tinh tinh, có nghĩa là khi ta trải một quyển sách của ta ra, đặt kế bên một quyển sách của tinh tinh, ta sẽ thấy 98% công thức/gen của ta có ở trong sách của tinh tinh, thậm chí ở cùng một chương, và ngược lại. Nhưng vị trí có thể khác, độ dài của mỗi công thức sẽ khác, và nội dung chắc chắn khác nhiều hơn giữa sách của chúng ta với nhau. Sẽ có những công thức chúng nó có mà chúng ta không có, và ngược lại, ví dụ như HAR1F, được biểu hiện mạnh mẽ ở vỏ não người.
Khi so sánh “sách” của người và của 3 vượn lớn: hắc tinh tinh, gorilla và đười ươi, ta thấy có một đoạn trên một chương – một đoạn NST (2 ở người và 2A ở tinh tinh) – của cả ta và tinh tinh đều bị đảo ngược.
Phần nâng cao quy trình kiểm tra ADN nhận bà con của người
Bấm xem phần nâng cao
Khi kiểm tra bạn với mẹ bạn, chẳng ai rảnh mà kiểm toàn bộ ADN vì tuyệt đại đa số các vùng trên bộ gen của chúng ta PHẢI giống nhau vì chúng ta đều cùng một loài. Cái họ kiểm tra là các marker, các vùng ngắn lặp lại liên tục (STR) rất khác biệt giữa cùng một gen ở các cá thể người.
Ví dụ, đây là đoạn THO1 nằm trên nhiễm sắc thể số 11
…TCATTCATTCATTCATTCATTCATTCATTCATTCAT…
Ở đây, “TCAT” được lặp lại 9 lần.
Kết quả hình ảnh cho short tandem repeats
Vì người lưỡng bội, nghĩa là các nhiễm sắc thể đều đi theo cặp, ta sẽ có 2 con số cho mỗi vùng ADN, ví dụ, kết quả trong hình trên là 6, 8.

N

Một nửa số NST chắc chắn phải đến từ mẹ, một nửa còn lại chắc chắn phải đến từ cha, nên xét bất cứ vùng nào ta cũng chỉ có thể có 4 trường hợp.

Paternity Test Diagram
N

Có thể xem chi tiết tiếng Việt tại đây.

Đối chiếu, nếu có một marker bạn giống hay khác với một người, thì còn chờ hạ hồi phân giải (đột biến chẳng hạn?), nếu có 16 marker trùng khớp hoặc trớt quớt thì xác suất là >99.99%. Nếu có thêm ADN của mẹ, thì gần như không thể chắc hơn được nữa.

Hỏi bạn đọc, ai nhiều khả năng là cha đứa trẻ này?

N

Vậy, sự tương đồng của chúng ta và tinh tinh chẳng có gì mâu thuẫn với quy luật di truyền, vì một bên là thừa kế trực tiếp nhiễm sắc thể, một bên là có cùng 98% số loại gen. Nếu ông Parker thật sự là một nhà di truyền, ông chắc chắn biết điều này, và chỉ đang lắt léo để công kích tiến hóa, dù phải phỉnh gạt người xem. “Chúng ta chỉ giống nhau tối đa khoảng 93%?” Còn tôi tuyên bố 96,69% số liệu trên internet không đi kèm nguồn là số liệu chế.

“Mây chứa 98% là nước, con sứa cũng chứa 98% là nước, dưa hấu cũng chứa 98% là nước. Sử dụng logic của thuyết tiến hóa thì không có sự khác nhau giữa mây, con sứa và dưa hấu. Nhưng chính 2% khác biệt kia tạo nên sự khác biệt rất lớn giữa người và tinh tinh.”

Nói 98% giống nghĩa là 2% khác, ai nói tinh tinh và người không khác? Và cũng không ai cãi là không phải chính 2% đó tạo nên khác biệt rất lớn cả. Ai đâu? Cái các nhà khoa học lý luận là vì ta biết ADN càng giống thì càng gần, ADN tinh tinh & bonobo giống với người nhất, nên tinh tinh & bonobo là bà con gần nhất. Ông Hưng là giảng viên dạy Toán, sao lại có thể hí hửng đăng lại phiên bản logic dưa hấu “quái thai” trên?

“Chúng ta cùng thở một thứ không khí, chúng ta có cơ và xương, chúng ta cùng tiêu hóa những thứ giống nhau. Nếu chúng ta được tạo dựng bởi cùng một Đức Chúa Trời, chúng ta có thể chờ đợi nhiều thứ giống nhau…..”

Như đã đề cập, màn liệt kê này dường như cố tình nói tránh những đặc điểm độc nhất chỉ có hominid mới có chung về sinh lý và trí não, thay vào đó lại lan man những chi tiết chung chung của động vật. Nhưng phải chăng sự giống nhau của sinh vật cũng có thể là bằng chứng hoàn hảo cho việc chúng có cùng một tác giả? Ở một bài sắp tới, chúng ta sẽ cùng mô hình hóa thuyết tiến hóa và Sáng tạo luận – hệ tư tưởng cho rằng vạn vật được tạo ra từ thế lực siêu nhiên – để đối chiếu với dữ liệu.

CHỐNG SÁCH VỞ VÀ BẰNG CHỨNG CŨ

Ông Hưng trích cuốn sách Holt Biology rồi ca thán “Chao ôi, chỉ với bàn tay 5 ngón, các nhà tiến hóa đã xếp loài người vào chung một rọ với loài khỉ, vượn!”

N

Nghe giọng văn của cuốn sách tôi đã nghi nghi. Mò ra thì hóa ra đó là cuốn sách cho học sinh trung học, không phải tài liệu khoa học. Người chống tiến hóa sao lại hay lôi mấy cuốn sách tuổi teen ra làm như đó là bằng chứng duy nhất của toàn sinh học nhỉ? Nhiệm vụ của sách giáo khoa là vặt lông, phơi khô, băm nhỏ, chưng cất… kiến thức sao cho vừa miệng học sinh, nhiều khi phải hy sinh sự chính xác để truyền tải mấu chốt vấn đề. Chừng nào trên Nature hay Science đăng bài bảo “thật sự chúng tớ ứ có manh mối gì ngoài bàn tay 5 ngón để nói người với linh trưởng có bà con đâu” đi rồi tính.
Chẳng hiểu các nhà khoa học nghĩ sao lại coi khỉ, vượn là bà con gần gũi nhất với con người nữa! Rõ ràng ngoài bàn tay 5 ngón thì chúng chẳng giống chúng ta chỗ nào hơn ngựa hay chim :3.
Đấy, giống chỗ nào?
Còn thực tế, kết luận chúng ta là linh trưởng dựa trên bàn tay 5 ngón VÀ cả cơ thể với cấu trúc xương tương đồng không thể chối cãi được mà chính các nhà khoa học tiền Darwinghi nhận VÀ sự giống nhau về sinh lý (ví dụ như hiện tượng kinh nguyệt) VÀ sự tương đồng về nội tạng VÀ ADN khớp nhất trong sinh giới VÀ sự gần gũi di truyền đủ nhiều để ta có thể mắc bệnh nếu ăn chúng như ăn thịt đồng loại hoặc truyền bệnh cho chúng VÀ trí tuệ đủ thông minh để nhận thức được bản thể, tư duy trừu tượng cũng như vượt qua bài kiểm tra gương và đủ thứ bài khác VÀ VÂN VÂN…Có thế mà đã phân loại một cách khách quan ta vào với khỉ vượn theo đúng phương pháp ta dùng với mọi loài khác, thật sự quá hấp tấp, tắc trách! Các người có biết các người làm tổn thương lòng tự ái của những người muốn nhân loại phải đặc biệt BẰNG MỌI GIÁ, kể cả xuyên tạc khoa học không?
Tôi vẫn chẳng thấy giống chỗ nào cả :P.

N

N

Thực sự là chúng ta có 5 ngón, thực sự là 5 ngón ấy giống lắm với 5 ngón của linh trưởng, thực sự đó là đặc điểm phân loại linh trưởng, thế ông Hưng muốn sách nói sao? Thực sự, các nhà phân loại không cần đặc điểm nào đó phải hoành tráng hay quan trọng, chỉ cần nó đặc trưng là có thể dùng đại diện cho nhóm. Với nhóm thú guốc chẵn, đó có thể chỉ là một cái xương nhỏ, có hình dáng như cái ròng rọc đôi ở mắt cá; còn có vụ đặt tên cho cả liên ngành động vật chỉ dựa trên việc phôi thai hình thành miệng hay hậu môn trước! (Ví dụ, Deuterostomia, Động vật miệng thứ sinh, nghĩa là lỗ *** có trước – trong đó bao gồm cả bạn và tôi 😀 ). Dù những chi tiết ấy có vụn vặt đến cỡ nào, có thể gây thất vọng hay khó hiểu cho người bình thường chúng ta đến cỡ nào, chỉ cần không nhóm nào khác có chúng, đó sẽ là đặc điểm phân loại. Đằng này, “chỉ với bàn tay 5 ngón”, linh trưởng có ưu thế đặc biệt về sinh tồn như leo trèo, cầm công cụ thô sơ này, bẻ trái này… rồi sau này xuất hiện bàn tay có thể làm 1 tỷ công việc từ thô sơ đến tinh xảo nhất như của chúng ta – bàn tay 5 ngón quá quan trọng đi chứ!

Sự thật là các nhà khoa học hiện không có bàn cãi việc tiến hóa có xảy ra hay không, hay muôn loài có chung nguồn gốc hay không. Đòi hỏi phải dạy những tư tưởng lỗi thời, có nguồn gốc tâm linh cổ đại thay thế hoặc song song với thuyết tiến hóa cũng như đòi dạy hóa học chung với giả kim thuật, thần kinh học với não tưởng học, vật lý với ma thuật, thiên văn với chiêm tinh. Không! Nên khoa học và ngành giáo dục SẼ KHÔNG BAO GIỜ nuông chiều một bộ phận chống phá dốt nát mà để mặc trẻ em tiếp nhận những điều mà chúng ta đã biết là sai!

Ông Hưng lại phẫn nộ khi sách Miller & Levine ghi rằng cũng còn cự cãi nhiều về nguồn gốc con người đấy, nhưng ít ra việc chung tổ tiên với linh trưởng thì không. Đoạn này Miller & Levine không bàn những ý tưởng táo tợn như kiểu giả thuyết vượn nước, đơn giản chỉ là một câu rất cẩn trọng và thực sự phản ánh đúng quan điểm cộng đồng khoa học, nhưng ông Hưng xem nhiêu đó là quá đáng.

“Đó là NÓI DỐI! […] không có sự nhất trí của tất cả các nhà nghiên cứu về vấn đề này. Sự thật là có rất nhiều nhà nghiên cứu không tán thành với quan điểm con người có chung tổ tiên với hắc tinh tinh và vượn.” (thế hắc tinh tinh không phải là vượn?)
Rất nhiều là bao nhiêu, và họ là ai nào? Không phải mấy người ở trên rồi đó: Milton là kỹ sư (kỹ sư không làm nghiên cứu khoa học); Bowden cũng là kĩ sư, ông này bá đạo còn tin vào mô hình Địa Tâm, nói rằng “khoa học thực thụ sẽ ủng hộ những gì viết trong <tên một kinh tôn giáo nổi tiếng>”; rằng các trường đại học và nhà khoa học ém nhẹm thí nghiệm chứng minh mặt trời quay quanh Trái Đất! Nghe quen không?; Parker là cử nhân về sinh học, thạc sĩ sinh học/sinh lý với đề tài về nội tiết lưỡng cư như nòng nọc, bằng tiến sĩ về dạy sinh học, nên không biết “là một nhà di truyền” ở đâu ra?; và Eastman hóa ra là bác sĩ… Họ không có đủ nghiệp vụ căn bản tham gia nghiên cứu di truyền và tiến hóa, đừng nói tới di truyền và tiến hóa hominin.
Ờ, chắc là nếu người chống tiến hóa gào thật to và thật nhiều lần rằng “thuyết tiến hóa không có bằng chứng”, thì sẽ đối trọng lại được với khoa học.
Người chống tiến hóa hay chỉ trích người ủng hộ tiến hóa là hay chỉ trích người khác dốt. Giờ tôi nói luôn: Đó là họ tự chuốc lấy, vì “Khẳng định to cần cơ sở vững” (mượn lời cụ Carl Sagan), dù ở cuộc họp những người cắm hoa hay hội thảo khoa học quốc tế. Nếu anh nói điều ai cũng thừa nhận như Trái Đất hình phỏng cầu, hay anh có chuyên môn về điều mình nói tới, như một Tiến sĩ địa chất nói về mảng kiến tạo, thì đương nhiên người ta dễ chấp nhận hơn. Thậm chí, trên các diễn đàn nhà nghề vẫn có những anh tay mơ nói chuyện người ta chịu nghe, vì anh ta đã chuẩn bị rất kỹ tài liệu dẫn chứng. Đằng này anh được đào tạo chẳng hơn ai, anh trần truồng không một mảnh bằng chứng che thân xông vào cộng đồng chuyên ngành nói toàn những điều phi lí và méo mó, thậm chí mất căn bản, trái ngược hoàn toàn với kiến thức nền mà lại đòi được “lắng nghe”, “đối xử công bằng” và “tự do học thuật”. Ở đâu có chuyện đó?
Bạn vẫn cảm thấy thuyết tiến hóa còn quá mập mờ vụ sách giáo khoa?
Thế là đã tử tế chán so với vật lý thiên văn: gần như không học sinh nào được biết rằng thật ra KHÔNG ĐỜI NÀO có thể thệ hiện kích cỡ và cự li của các hành tinh trong hệ Mặt Trời trên một trang giấy mà ta còn nhìn thấy được Trái Đất (xem mô hình chính xác đến mắc mệt ở đây). Và có sách nào nói cho học sinh biết rằng 99.99[…]99% thời gian các hành tinh không sắp thẳng hàng như trong hình vẽ không? Một sự lừa dối trơ trẽn, ém nhẹm thông tin, đầu độc những bộ óc ngây thơ hết lòng tin tưởng sách vở, thầy cô! *Thở dài*. Điều này cũng chẳng khác gì việc tụi nhỏ bước ra khỏi lớp nghĩ rằng di truyền loài nào cũng rạch ròi như đậu Hà Lan, hay “phân tử” là mấy cục nhựa, hay “ta coi cục méo xẹo này là hình cầu”… không có môn nào dạy trong trường có được 1/10 độ phức tạp cũng như độ chuẩn xác của lĩnh vực thực tế. Như tôi đã nói nhiều lần, sách giáo khoa cho học sinh phổ thông trở xuống đơn thuần chỉ là một muỗng canh kiến thức, của mỗi ngành học khổng lồ, đút các em nuốt trọng lẹ lẹ cho có rồi đi ra đời. Nếu thực sự tâm huyết thì theo nghiệp, hoặc đọc báo chuyên ngành; nếu không đủ quan tâm, xin đừng vội chỉ trích.
***
chimp-hand
CHÚNG TA ĐẶC BIỆT. Chúng ta có thể lao vào lửa vì một người không quen, và ôm bom biến một cái đám cưới thành đám ma. Chúng ta sản sinh ra nhiều bậc thông tuệ đến nỗi vài ngàn năm sau vẫn có người phải kính sợ, và cũng lắm kẻ đần độn đến mức tự loại gen của mình ra khỏi quần thể vì một lần nổi hứng ngang hông. Chúng ta có thể phóng phi thuyền lên mặt trăng, cũng có thể cướp máy bay lao vào trung tâm thương mại. Đọc được những dòng này, không những bạn đang sở hữu năng lực độc nhất vô nhị trong sinh giới, mà bạn đã phúc phần hơn 99.999…% con người từng tồn tại (biết chữ, có mạng internet, không phải liên tục lo lắng cho tính mạng hay làm việc quần quật để có cái ăn). Chúng ta không cần phải dìm hàng những loài khác, hoặc tự tô vẽ hoa lá cành những đặc điểm của chúng ta thành số một thế giới, hay ra vẻ chúng ta tự đạt được những ưu thế ấy – như một đứa trẻ nhà giàu hư hỏng làm như thể tiền là do tự nó kiếm, và nó giỏi hơn tất cả những đứa khác.
CHÚNG TA HẾT SỨC ĐẶC BIỆT, và đã đến lúc chúng ta tự tin về điều đó mà  không cần chối bỏ rằng chúng ta 100% là một vượn lớn.

10 Comments

  1. đọc những bài của ông Hưng sặc mùi tôn giáo. theo ông Hưng thì chúa tạo ra tất cả, mà ông không biết rằng chúa là tự nhiên và có các quy luật của nó. Con người cũng là một sản phẩm của tự nhiên. Khoa học là vẫn là chân lý.

    Số lượt thích

    1. Chào bạn Bùi Thanh. Cảm ơn đã bình luận. Đã có quá nhiều mâu thuẫn xảy ra vì một bên nào đó muốn độc quyền chân lý. Dù là người đam mê khoa học và tự nhận sứ mạng bảo vệ nó tôi vẫn cho rằng khoa học chỉ có thể đưa ra “lý” chứ chưa thể khẳng định “chân”. Điều đó hoàn toàn bình thường, và chỉ cần tất cả mọi người trong lúc tìm “chân lý” cho riêng mình giữ được cái “chân” trong “chân thật” thì chúng ta sẽ hòa hợp và phát triển biết mấy – rất tiếc, ông Hưng không làm được điều này.

      Số lượt thích

    1. Chào bạn Lộc. Lúc đầu khi bắt đầu công cuộc phản biện ông Hưng tôi cũng đã rất bất ngờ vì tại sao một người có đức tin sắt đá rằng điều mình đang theo đuổi là đúng phải bóp méo sự thật. Giờ tôi nhìn nhận rằng động lực cho những điều sai ông đã làm đến từ khát khao điều mình tin phải là đúng, vì ông không thể đối diện với bất cứ viễn cảnh nào khác. Do đó, tôi không nghĩ ông Hưng cuồng tín, mà ngược lại, đức tin không đủ lớn để ông dũng cảm và trung thực đánh giá sự việc.

      Số lượt thích

Trả lời

Mời bạn điền thông tin vào ô dưới đây hoặc kích vào một biểu tượng để đăng nhập:

WordPress.com Logo

Bạn đang bình luận bằng tài khoản WordPress.com Đăng xuất /  Thay đổi )

Google+ photo

Bạn đang bình luận bằng tài khoản Google+ Đăng xuất /  Thay đổi )

Twitter picture

Bạn đang bình luận bằng tài khoản Twitter Đăng xuất /  Thay đổi )

Facebook photo

Bạn đang bình luận bằng tài khoản Facebook Đăng xuất /  Thay đổi )

Connecting to %s